Stem-loop sequence tca-mir-3845

AccessionMI0016316 (change log)
DescriptionTribolium castaneum miR-3845 stem-loop
Stem-loop
   cgaaa    -       g  auaaa    -    ucaau      c  -    gag     u    c gauua   c 
5'      uggu gauuuau ua     guug gugg     guccca gc cuug   uuauc uggc g     agu g
        |||| ||||||| ||     |||| ||||     |||||| || ||||   ||||| |||| |     ||| a
3'      acua cugggua au     caac cacc     cagggu ug gaau   ggugg accg c     ucg a
   uauug    a       g  accug    g    -----      -  u    aaa     u    - augug   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 16474394-16474540 [-]
intergenic
Database links

Mature sequence tca-miR-3845-5p

Accession MIMAT0018738
Sequence

33 - 

ucaaugucccacgccuugg

 - 51

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3845-3p

Accession MIMAT0018739
Sequence

100 - 

auaaguguugggacccacgc

 - 119

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).