Stem-loop sequence tca-mir-3477

AccessionMI0016315 (change log)
DescriptionTribolium castaneum miR-3477 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   ugcac  uu   ug     c  ua        ug   ac g     uuug 
5'      gc  gac  cguuu gu  aucucauu  gua  u ugagg    u
        ||  |||  ||||| ||  ||||||||  |||  | |||||     
3'      ug  uug  guaaa ca  uaggguaa  cau  a acucc    u
   acuuu  uu   gu     a  gc        gu   -c g     uuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 19663710-19663810 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3477
tca-mir-283ChLG3: 19667898-19667973 [-]
tca-mir-3477ChLG3: 19663710-19663810 [-]
tca-mir-12ChLG3: 19663493-19663579 [-]
Database links

Mature sequence tca-miR-3477-5p

Accession MIMAT0018736
Sequence

23 - 

uaaucucauuugguaacugugagg

 - 46

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3477-3p

Accession MIMAT0018737
Sequence

59 - 

ucagacuacugaaugggaucgac

 - 81

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).