Stem-loop sequence tca-mir-3844

AccessionMI0016314 (change log)
DescriptionTribolium castaneum miR-3844 stem-loop
Stem-loop
   auuua      gaga         gaaaaccc        u    g 
5'      uguuuu    ggcaccuca        cacgcaca guuu u
        ||||||    |||||||||        |||||||| ||||  
3'      acgaga    ccguggagu        gugugugu uaaa a
   guuaa      ----         --aaaaua        -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 5628773-5628859 [-]
intergenic
Database links

Mature sequence tca-miR-3844-5p

Accession MIMAT0018734
Sequence

15 - 

aggcaccucagaaaaccccacgc

 - 37

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3844-3p

Accession MIMAT0018735
Sequence

52 - 

auugugugugauaaaaugaggugcca

 - 77

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).