Stem-loop sequence tca-mir-279c

AccessionMI0016312 (change log)
DescriptionTribolium castaneum miR-279c stem-loop
Literature search

2 open access papers mention tca-mir-279c
(8 sentences)

Stem-loop
   -uu  g    --uuaaa          uuu          uu  g       uu  g 
5'    uc ccgc       uucauauuuu   cggguguucg  uc agucaca  gu a
      || ||||       ||||||||||   ||||||||||  || |||||||  || u
3'    ag ggcg       agguaugaag   gcuuacaagc  ag ucagugu  ua u
   uuc  -    ccuaaaa          cuc          -u  a       uu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 15204345-15204456 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-279c
tca-mir-3889ChLG3: 15203725-15203820 [+]
tca-mir-3841ChLG3: 15203860-15203954 [+]
tca-mir-3840ChLG3: 15203983-15204073 [+]
tca-mir-9cChLG3: 15204096-15204202 [+]
tca-mir-2944aChLG3: 15204224-15204312 [+]
tca-mir-279cChLG3: 15204345-15204456 [+]
tca-mir-3843ChLG3: 15204456-15204547 [+]
Database links

Mature sequence tca-miR-279c-5p

Accession MIMAT0018730
Sequence

28 - 

cggguguucguuucgagucaca

 - 49

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-279c-3p

Accession MIMAT0018731
Sequence

65 - 

ugacuagaucgaacauucgcucg

 - 87

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).