Stem-loop sequence tca-mir-3842

AccessionMI0016311 (change log)
DescriptionTribolium castaneum miR-3842 stem-loop
Stem-loop
   uccca    ---cu           gg         u  g   g   gg 
5'      caac     aacaacaagga  aaaaacgag cg ucg cau  c
        ||||     |||||||||||  ||||||||| || ||| |||  a
3'      guug     uuguuguuccu  uuuuugcuu gc agc gua  c
   uaaaa    cuauu           -a         c  a   -   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 560957-561052 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3842
tca-mir-3842ChLG3: 560957-561052 [+]
tca-mir-71ChLG3: 562386-562464 [+]
tca-mir-2-3ChLG3: 562500-562582 [+]
tca-mir-13aChLG3: 562623-562702 [+]
tca-mir-13bChLG3: 562739-562812 [+]
tca-mir-2-1ChLG3: 562865-562952 [+]
tca-mir-2-2ChLG3: 563018-563102 [+]
Database links

Mature sequence tca-miR-3842-5p

Accession MIMAT0018728
Sequence

19 - 

aggaggaaaaacgagucgg

 - 37

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3842-3p

Accession MIMAT0018729
Sequence

56 - 

gaacgcuucguuuuuauccuug

 - 77

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).