Stem-loop sequence tca-mir-3841

AccessionMI0016310 (change log)
DescriptionTribolium castaneum miR-3841 stem-loop
Stem-loop
   cucuu   g  u     uuc   c   cu    auuc         g 
5'      uuc ca uaucu   gug gau  uucc    cuacuuguu u
        ||| || |||||   ||| |||  ||||    |||||||||  
3'      gag gu auaga   cac cua  aagg    gaugaauag u
   cuuuu   g  u     uua   u   uu    -cau         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 15203860-15203954 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3841
tca-mir-3889ChLG3: 15203725-15203820 [+]
tca-mir-3841ChLG3: 15203860-15203954 [+]
tca-mir-3840ChLG3: 15203983-15204073 [+]
tca-mir-9cChLG3: 15204096-15204202 [+]
tca-mir-2944aChLG3: 15204224-15204312 [+]
tca-mir-279cChLG3: 15204345-15204456 [+]
tca-mir-3843ChLG3: 15204456-15204547 [+]
Database links

Mature sequence tca-miR-3841-5p

Accession MIMAT0018726
Sequence

20 - 

cgugcgaucuuuccauuccuacuug

 - 44

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3841-3p

Accession MIMAT0018727
Sequence

57 - 

uaguacggaauuaucucac

 - 75

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).