Stem-loop sequence tca-mir-3839

AccessionMI0016308 (change log)
DescriptionTribolium castaneum miR-3839 stem-loop
Stem-loop
   auaau     -a   -a u       u   --       u      u     -  u 
5'      gagcg  gau  g aguuuug cac  aggaaau gcgaua guucg aa a
        |||||  |||  | ||||||| |||  ||||||| |||||| ||||| ||  
3'      uucgu  cua  c uuaaaac gug  uccuuug cguugu caagu uu u
   -----     aa   ag -       -   ca       c      u     a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 5757862-5757963 [+]
intergenic
Database links

Mature sequence tca-miR-3839-5p

Accession MIMAT0018722
Sequence

26 - 

cacaggaaauugcgauauguucg

 - 48

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3839-3p

Accession MIMAT0018723
Sequence

61 - 

acuuguugccguuuccuacgu

 - 81

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).