Stem-loop sequence tca-mir-3838

AccessionMI0016307 (change log)
DescriptionTribolium castaneum miR-3838 stem-loop
Stem-loop
   --aca   aua    -        uag    uua  cuaa    -u     uaa      uuu    a        
5'      gag   uucg cgcaaagu   aggu   gc    gucg  cuuaa   aauguu   aaua uugagaa 
        |||   |||| ||||||||   ||||   ||    ||||  |||||   ||||||   |||| |||||| a
3'      cuu   aagu guguuucg   ucca   ug    uagc  gaguu   uuacaa   uugu aauuuua 
   uaaaa   cgg    a        ccg    -uc  -ucc    cu     ---      -uc    a        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 15062154-15062294 [+]
intergenic
Database links

Mature sequence tca-miR-3838-5p

Accession MIMAT0018720
Sequence

27 - 

guuuagccuaagucgucuua

 - 46

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3838-3p

Accession MIMAT0018721
Sequence

92 - 

uuugaguccgauccugucuaccugcc

 - 117

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).