Stem-loop sequence tca-mir-2944a

AccessionMI0016306 (change log)
DescriptionTribolium castaneum miR-2944a stem-loop
Gene family MIPF0001335; mir-2944
Stem-loop
   aacuc               g     u   -      u  uuca 
5'      gcugaaacuguggag aacua ugg ugugau ug    u
        ||||||||||||||| ||||| ||| |||||| ||     
3'      ugacuuugacacuuc uugau acc acacua ac    u
   uuuua               a     u   g      u  uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 15204224-15204312 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-2944a
tca-mir-3889ChLG3: 15203725-15203820 [+]
tca-mir-3841ChLG3: 15203860-15203954 [+]
tca-mir-3840ChLG3: 15203983-15204073 [+]
tca-mir-9cChLG3: 15204096-15204202 [+]
tca-mir-2944aChLG3: 15204224-15204312 [+]
tca-mir-279cChLG3: 15204345-15204456 [+]
tca-mir-3843ChLG3: 15204456-15204547 [+]
Database links

Mature sequence tca-miR-2944a-5p

Accession MIMAT0018718
Sequence

18 - 

gaggaacuauuggugugauuug

 - 39

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-2944a-3p

Accession MIMAT0018719
Sequence

52 - 

uaucacagccauuaguuacuucac

 - 75

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).