Stem-loop sequence tca-mir-316

AccessionMI0016305 (change log)
DescriptionTribolium castaneum miR-316 stem-loop
Gene family MIPF0000254; mir-316
Literature search

1 open access papers mention tca-mir-316
(2 sentences)

Stem-loop
   -gc  c       a  gu     uu   g        c  c  uu 
5'    ca acuugug ac  gucuu  ucc cuuugcug cg ug  c
      || ||||||| ||  |||||  ||| |||||||| || ||   
3'    gu ugagcac ug  cggag  agg gagacgac gc gc  u
   cca  -       g  au     -u   a        c  u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 1000551-1000639 [+]
intergenic
Database links

Mature sequence tca-miR-316-5p

Accession MIMAT0018716
Sequence

17 - 

ugucuuuuuccgcuuugcugc

 - 37

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-316-3p

Accession MIMAT0018717
Sequence

54 - 

ccagcagagaggaugaggcuag

 - 75

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).