Stem-loop sequence tca-mir-9c

AccessionMI0016304 (change log)
DescriptionTribolium castaneum miR-9c stem-loop
Literature search

1 open access papers mention tca-mir-9c
(3 sentences)

Stem-loop
   ugauu   c  -           cu    u     uc   c       a  au 
5'      uug ua acgcguuauca  ucuu gguga  uag cguguga uu  u
        ||| || |||||||||||  |||| |||||  ||| ||||||| ||  u
3'      aac au uguguaguagu  agaa ccgcu  auc gcgcacu aa  u
   agguc   a  c           uu    -     ga   u       a  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 15204096-15204202 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-9c
tca-mir-3889ChLG3: 15203725-15203820 [+]
tca-mir-3841ChLG3: 15203860-15203954 [+]
tca-mir-3840ChLG3: 15203983-15204073 [+]
tca-mir-9cChLG3: 15204096-15204202 [+]
tca-mir-2944aChLG3: 15204224-15204312 [+]
tca-mir-279cChLG3: 15204345-15204456 [+]
tca-mir-3843ChLG3: 15204456-15204547 [+]
Database links

Mature sequence tca-miR-9c-5p

Accession MIMAT0018714
Sequence

25 - 

ucuuuggugaucuagccgugug

 - 46

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-9c-3p

Accession MIMAT0018715
Sequence

63 - 

acgcgucuaagucgccaagauuug

 - 86

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).