Stem-loop sequence tca-mir-2796

AccessionMI0016303 (change log)
DescriptionTribolium castaneum miR-2796 stem-loop
Gene family MIPF0001057; mir-2796
Stem-loop
   aucga  uu   g  - -a        uauuaac      --   c         -       u       c    ggaua 
5'      gc  ucg ug c  gaagccgc       guggug  acg aagaguagg gguuucu ucggccu cagc     a
        ||  ||| || |  ||||||||       ||||||  ||| ||||||||| ||||||| ||||||| ||||      
3'      cg  agu ac g  cuucggcg       cauuac  ugc uuuucguuc ucaaagg ggccgga guug     u
   uuuug  -u   a  u cc        ucgcuuc      gu   a         a       c       u    agaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 14198660-14198817 [-]
intergenic
Database links

Mature sequence tca-miR-2796-5p

Accession MIMAT0018712
Sequence

49 - 

agggguuucuuucggccuccagcg

 - 72

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-2796-3p

Accession MIMAT0018713
Sequence

87 - 

guaggccggcggaaacuacuugc

 - 109

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).