Stem-loop sequence tca-mir-3837

AccessionMI0016301 (change log)
DescriptionTribolium castaneum miR-3837 stem-loop
Stem-loop
   aaaaa     gucua     -ua      ga    uuu     aa      aaga 
5'      cauuu     auaaa   aaucuu  gacg   uuuua  cuuguu    c
        |||||     |||||   ||||||  ||||   |||||  ||||||    a
3'      gugaa     uauuu   uuagaa  cugu   agagu  gagcga    u
   gacaa     ---ag     uug      gg    uau     ga      guau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 2554348-2554456 [+]
intergenic
Database links

Mature sequence tca-miR-3837-5p

Accession MIMAT0018708
Sequence

4 - 

aacauuugucuaauaaauaaau

 - 25

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3837-3p

Accession MIMAT0018709
Sequence

84 - 

aagauuguuuuuaugaaag

 - 102

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).