Stem-loop sequence tca-mir-308

AccessionMI0016300 (change log)
DescriptionTribolium castaneum miR-308 stem-loop
Stem-loop
   ucaaa   -  --u   ug  g               g       a     gu 
5'      ugg gg   aau  gc cccugcgcaggauuu cuuguga ugggu  g
        ||| ||   |||  || ||||||||||||||| ||||||| |||||  c
3'      acc cu   uug  ug ggggcgugucuuaaa ggacacu acuua  u
   ---ac   a  guu   gu  a               a       a     gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 4378800-4378902 [-]
intergenic
Database links

Mature sequence tca-miR-308-5p

Accession MIMAT0018706
Sequence

25 - 

cgcaggauuugcuugugaaugg

 - 46

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-308-3p

Accession MIMAT0018707
Sequence

60 - 

aaucacaggaaaauucugugcg

 - 81

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).