Stem-loop sequence tca-mir-3835

AccessionMI0016298 (change log)
DescriptionTribolium castaneum miR-3835 stem-loop
Stem-loop
   uaaaa   -ug     a ugau   uu     ua        --   ua 
5'      ucu   uugcc c    gaa  acugc  gaaucuuc  cuu  a
        |||   ||||| |    |||  |||||  ||||||||  |||   
3'      aga   aacgg g    cuu  ugacg  cuuaggag  gaa  u
   --aaa   uua     a ---u   --     --        uu   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 2187947-2188034 [+]
intergenic
Database links

Mature sequence tca-miR-3835-5p

Accession MIMAT0018702
Sequence

12 - 

ugccacugaugaauuacugcuagaau

 - 37

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3835-3p

Accession MIMAT0018703
Sequence

54 - 

uugaggauucgcaguuucugaggcaa

 - 79

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).