Stem-loop sequence tca-mir-3834

AccessionMI0016297 (change log)
DescriptionTribolium castaneum miR-3834 stem-loop
Stem-loop
   --  aug         u      g   uccacc 
5'   gg   gaaugaugu auuuuc acc      a
     ||   ||||||||| |||||| |||      c
3'   cc   cuuacugca ugaaag ugg      c
   cu  --a         -      a   ucucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 1971892-1971955 [+]
intergenic
Database links

Mature sequence tca-miR-3834-5p

Accession MIMAT0018700
Sequence

9 - 

ugauguuauuuucgaccucc

 - 28

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3834-3p

Accession MIMAT0018701
Sequence

36 - 

ucucugguagaaaguacgucau

 - 57

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).