Stem-loop sequence tca-mir-iab-8

AccessionMI0016296 (change log)
DescriptionTribolium castaneum miR-iab-8 stem-loop
Gene family MIPF0000854; mir-iab-8
Stem-loop
   uga     --g         u            g    a  g  caga 
5'    aaugu   gccuccugu acguauacugaa guau cc ga    a
      |||||   ||||||||| |||||||||||| |||| || ||     
3'    uuaca   ugggggaca ugcauaugacuu caua gg cu    a
   guc     auu         -            a    -  a  caca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG2: 7614302-7614395 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-iab-8
tca-mir-iab-8ChLG2: 7614302-7614395 [+]
tca-mir-iab-4ChLG2: 7614308-7614388 [-]
Database links

Mature sequence tca-miR-iab-8-5p

Accession MIMAT0018698
Previous IDstca-miR-iab-5p
Sequence

18 - 

uuacguauacugaagguauaccggac

 - 43

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-iab-8-3p

Accession MIMAT0018699
Previous IDstca-miR-iab-3p
Sequence

55 - 

aggauacauucaguauacg

 - 73

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).