Stem-loop sequence tca-mir-3832

AccessionMI0016294 (change log)
DescriptionTribolium castaneum miR-3832 stem-loop
Stem-loop
   uua a              a    c         c        --   uuu 
5'    g uuaacuggaguaaa cggg gaaaugauu uggugugu  agu   g
      | |||||||||||||| |||| ||||||||| ||||||||  |||    
3'    c aauugacuuuauuu gucc cuuugcuaa accacaua  uua   u
   gca g              -    u         a        cu   ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLGX: 2759903-2760003 [-]
intergenic
Database links

Mature sequence tca-miR-3832-5p

Accession MIMAT0018694
Sequence

22 - 

gggcgaaaugauucuggugugu

 - 43

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3832-3p

Accession MIMAT0018695
Sequence

62 - 

acaccaaaaucguuucuccugu

 - 83

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).