Stem-loop sequence tca-mir-3831

AccessionMI0016293 (change log)
DescriptionTribolium castaneum miR-3831 stem-loop
Stem-loop
   -    g      c         u       c -c   a    -  - u 
5'  guga cuuuuc aaacauugc auuuugu g  ucg uguc cg c c
    |||| |||||| ||||||||| ||||||| |  ||| |||| || |  
3'  uacu gaaaag uuuguaacg uaaaaca c  agc auag gc g c
   u    -      -         u       a ac   -    u  u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLGX: 6901709-6901799 [-]
intergenic
Database links

Mature sequence tca-miR-3831-5p

Accession MIMAT0018692
Sequence

12 - 

caaacauugcuauuuugucgcucgau

 - 37

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3831-3p

Accession MIMAT0018693
Sequence

55 - 

uacgacacaacaaaauugcaau

 - 76

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).