Stem-loop sequence tca-mir-3827

AccessionMI0016288 (change log)
DescriptionTribolium castaneum miR-3827 stem-loop
Stem-loop
   gcuuc   cu   cu          ----c  c     a 
5'      uca  gcg  gcugcggaug     cg aagau a
        |||  |||  ||||||||||     || ||||| a
3'      agu  cgu  ugauguuuac     gc uucua a
   uuuaa   uu   --          uuuua  c     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLGX: 3987712-3987786 [+]
intergenic
Database links

Mature sequence tca-miR-3827-5p

Accession MIMAT0018682
Sequence

6 - 

ucacugcgcugcugcggaugccgcaa

 - 31

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3827-3p

Accession MIMAT0018683
Sequence

44 - 

uccgauuuucauuuguaguugcuuug

 - 69

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).