Stem-loop sequence tca-mir-3826

AccessionMI0016287 (change log)
DescriptionTribolium castaneum miR-3826 stem-loop
Gene family MIPF0001217; mir-3817
Stem-loop
   agggu     ugua  ug                     -   c    a     gu 
5'      uguga    ac  gggccgguuucgaggcguggu ggg ggua uauua  a
        |||||    ||  ||||||||||||||||||||| ||| |||| |||||  a
3'      acacu    ug  uuugguuaaggcuccgcauca ccc cuau auaau  a
   caaac     uuug  gu                     g   -    c     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLGX: 5786920-5787032 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3826
tca-mir-3809ChLGX: 5796225-5796317 [-]
tca-mir-3825ChLGX: 5796077-5796171 [-]
tca-mir-3821ChLGX: 5795772-5795863 [-]
tca-mir-3818ChLGX: 5795452-5795544 [-]
tca-mir-11635ChLGX: 5795359-5795417 [-]
tca-mir-3813ChLGX: 5794687-5794779 [-]
tca-mir-3820ChLGX: 5794461-5794553 [-]
tca-mir-3814ChLGX: 5794132-5794223 [-]
tca-mir-6007ChLGX: 5790992-5791078 [-]
tca-mir-3810ChLGX: 5790589-5790690 [-]
tca-mir-3829ChLGX: 5788970-5789059 [-]
tca-mir-11636ChLGX: 5788871-5788927 [-]
tca-mir-3807ChLGX: 5788508-5788606 [-]
tca-mir-3815ChLGX: 5788162-5788256 [-]
tca-mir-3822ChLGX: 5787677-5787839 [-]
tca-mir-3812ChLGX: 5787259-5787378 [-]
tca-mir-3816ChLGX: 5787077-5787248 [-]
tca-mir-3826ChLGX: 5786920-5787032 [-]
tca-mir-3817ChLGX: 5786631-5786746 [-]
tca-mir-3828ChLGX: 5786420-5786520 [-]
tca-mir-3808ChLGX: 5786212-5786323 [-]
tca-mir-3811a-1ChLGX: 5785640-5785736 [-]
tca-mir-3806b-1ChLGX: 5785511-5785608 [-]
tca-mir-3811a-5ChLGX: 5785317-5785402 [-]
tca-mir-3806b-2ChLGX: 5785190-5785283 [-]
tca-mir-3811a-4ChLGX: 5784984-5785080 [-]
tca-mir-3806b-3ChLGX: 5784819-5784992 [-]
tca-mir-3811a-2ChLGX: 5784649-5784745 [-]
tca-mir-3806cChLGX: 5784537-5784597 [-]
tca-mir-3811a-3ChLGX: 5784317-5784420 [-]
tca-mir-3806b-4ChLGX: 5784181-5784306 [-]
tca-mir-3805bChLGX: 5783977-5784080 [-]
tca-mir-3811bChLGX: 5783739-5783850 [-]
tca-mir-3806ChLGX: 5783512-5783657 [-]
tca-mir-3805aChLGX: 5783347-5783442 [-]
tca-mir-3824ChLGX: 5781786-5781882 [-]
tca-mir-3823ChLGX: 5781595-5781685 [-]
Database links

Mature sequence tca-miR-3826-5p

Accession MIMAT0018680
Sequence

29 - 

cgaggcguggugggcgguaauau

 - 51

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3826-3p

Accession MIMAT0018681
Sequence

66 - 

cuauccccgacuacgccucgg

 - 86

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).