Stem-loop sequence tca-mir-3805b

AccessionMI0016278 (change log)
DescriptionTribolium castaneum miR-3805b stem-loop
Stem-loop
   aagaa    u c   uau   -    u    u    uu      u    guga 
5'      gauu g gcc   ucc cagg ccgu caca  cggauu uauu    a
        |||| | |||   ||| |||| |||| ||||  |||||| ||||     
3'      cuag c ugg   ggg guuc ggua gugu  gcuuag auaa    u
   aacaa    c -   -cu   u    u    -    cu      u    auua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLGX: 5783977-5784080 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3805b
tca-mir-6007ChLGX: 5790992-5791078 [-]
tca-mir-3810ChLGX: 5790589-5790690 [-]
tca-mir-3829ChLGX: 5788970-5789059 [-]
tca-mir-11636ChLGX: 5788871-5788927 [-]
tca-mir-3807ChLGX: 5788508-5788606 [-]
tca-mir-3815ChLGX: 5788162-5788256 [-]
tca-mir-3822ChLGX: 5787677-5787839 [-]
tca-mir-3812ChLGX: 5787259-5787378 [-]
tca-mir-3816ChLGX: 5787077-5787248 [-]
tca-mir-3826ChLGX: 5786920-5787032 [-]
tca-mir-3817ChLGX: 5786631-5786746 [-]
tca-mir-3828ChLGX: 5786420-5786520 [-]
tca-mir-3808ChLGX: 5786212-5786323 [-]
tca-mir-3811a-1ChLGX: 5785640-5785736 [-]
tca-mir-3806b-1ChLGX: 5785511-5785608 [-]
tca-mir-3811a-5ChLGX: 5785317-5785402 [-]
tca-mir-3806b-2ChLGX: 5785190-5785283 [-]
tca-mir-3811a-4ChLGX: 5784984-5785080 [-]
tca-mir-3806b-3ChLGX: 5784819-5784992 [-]
tca-mir-3811a-2ChLGX: 5784649-5784745 [-]
tca-mir-3806cChLGX: 5784537-5784597 [-]
tca-mir-3811a-3ChLGX: 5784317-5784420 [-]
tca-mir-3806b-4ChLGX: 5784181-5784306 [-]
tca-mir-3805bChLGX: 5783977-5784080 [-]
tca-mir-3811bChLGX: 5783739-5783850 [-]
tca-mir-3806ChLGX: 5783512-5783657 [-]
tca-mir-3805aChLGX: 5783347-5783442 [-]
tca-mir-3824ChLGX: 5781786-5781882 [-]
tca-mir-3823ChLGX: 5781595-5781685 [-]
Database links

Mature sequence tca-miR-3805b-5p

Accession MIMAT0018662
Sequence

26 - 

uccguucacauucggauuuuauugug

 - 51

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3805b-3p

Accession MIMAT0018663
Sequence

61 - 

uaugauucgucugugauggucuug

 - 84

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).