Stem-loop sequence tca-mir-3809

AccessionMI0016266 (change log)
DescriptionTribolium castaneum miR-3809 stem-loop
Stem-loop
   ucauu        g     a        u   c        aauu 
5'      aauguuug cggaa ucauaacu gcu gcugaugu    u
        |||||||| ||||| |||||||| ||| ||||||||    u
3'      uuguaaau gucuu aguauugg uga uggcugca    a
   cucgu        a     a        u   c        gaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLGX: 5796225-5796317 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3809
tca-mir-3809ChLGX: 5796225-5796317 [-]
tca-mir-3825ChLGX: 5796077-5796171 [-]
tca-mir-3821ChLGX: 5795772-5795863 [-]
tca-mir-3818ChLGX: 5795452-5795544 [-]
tca-mir-11635ChLGX: 5795359-5795417 [-]
tca-mir-3813ChLGX: 5794687-5794779 [-]
tca-mir-3820ChLGX: 5794461-5794553 [-]
tca-mir-3814ChLGX: 5794132-5794223 [-]
tca-mir-6007ChLGX: 5790992-5791078 [-]
tca-mir-3810ChLGX: 5790589-5790690 [-]
tca-mir-3829ChLGX: 5788970-5789059 [-]
tca-mir-11636ChLGX: 5788871-5788927 [-]
tca-mir-3807ChLGX: 5788508-5788606 [-]
tca-mir-3815ChLGX: 5788162-5788256 [-]
tca-mir-3822ChLGX: 5787677-5787839 [-]
tca-mir-3812ChLGX: 5787259-5787378 [-]
tca-mir-3816ChLGX: 5787077-5787248 [-]
tca-mir-3826ChLGX: 5786920-5787032 [-]
tca-mir-3817ChLGX: 5786631-5786746 [-]
tca-mir-3828ChLGX: 5786420-5786520 [-]
Database links

Mature sequence tca-miR-3809-5p

Accession MIMAT0018640
Sequence

20 - 

aucauaacuugcucgcuga

 - 38

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3809-3p

Accession MIMAT0018641
Sequence

55 - 

gucggucaguugguuaugaa

 - 74

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).