Stem-loop sequence tca-mir-2765

AccessionMI0016261 (change log)
DescriptionTribolium castaneum miR-2765 stem-loop
Gene family MIPF0001008; mir-2765
Stem-loop
   a  ag    gaaa     -   ----          -agu  u      a c          u     
5'  aa  uacc    uucuu gga    uauagugagg    gg aacucc c accguuggcg gugu 
    ||  ||||    ||||| |||    ||||||||||    || |||||| | |||||||||| ||| u
3'  uu  augg    aggaa ccu    augucgcucc    cc uugagg g uggcgaccgu caug 
   g  ga    -aac     a   cuua          aauu  -      a c          -     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG10: 4216016-4216141 [-]
intergenic
Database links

Mature sequence tca-miR-2765-5p

Accession MIMAT0018630
Sequence

34 - 

ugguaacuccaccaccguuggc

 - 55

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-2765-3p

Accession MIMAT0018631
Sequence

70 - 

cagcggucgaggaguuccuuaac

 - 92

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).