Stem-loop sequence tca-mir-3804b

AccessionMI0016259 (change log)
DescriptionTribolium castaneum miR-3804b stem-loop
Gene family MIPF0001255; mir-3804
Stem-loop
   cucgg      a   --ca        aaca   ucc       u c   uu 
5'      guuauc gcu    uugcacac    aug   acauucu g gau  c
        |||||| |||    ||||||||    |||   ||||||| | |||  a
3'      cgaugg cga    agcgugug    uac   uguaagg c cug  u
   gaaaa      -   cuaa        --aa   -cu       u a   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG10: 5151402-5151502 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3804b
tca-mir-3804bChLG10: 5151402-5151502 [-]
tca-mir-3804aChLG10: 5147561-5147639 [-]
Database links

Mature sequence tca-miR-3804b-5p

Accession MIMAT0018626
Sequence

18 - 

uugcacacaacaauguccacauucuu

 - 43

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3804b-3p

Accession MIMAT0018627
Sequence

61 - 

uggaauguuccauaagugugc

 - 81

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).