Stem-loop sequence tca-mir-3804a

AccessionMI0016258 (change log)
DescriptionTribolium castaneum miR-3804a stem-loop
Gene family MIPF0001255; mir-3804
Stem-loop
   auauu           auca   ucc       u    cu 
5'      uuuuggcacac    aug   acguuuu guga  u
        |||||||||||    |||   ||||||| ||||   
3'      aagaucgugug    uac   uguaaag cgcu  g
   ccaac           --aa   -cu       u    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG10: 5147561-5147639 [-]
intergenic
Clustered miRNAs
< 10kb from tca-mir-3804a
tca-mir-3804bChLG10: 5151402-5151502 [-]
tca-mir-3804aChLG10: 5147561-5147639 [-]
Database links

Mature sequence tca-miR-3804a-5p

Accession MIMAT0018624
Sequence

9 - 

uggcacacaucaauguccacguuuuu

 - 34

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-3804a-3p

Accession MIMAT0018625
Sequence

53 - 

auguuccauaagugugcuagaac

 - 75

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).