Stem-loop sequence tca-mir-3803

AccessionMI0016257 (change log)
DescriptionTribolium castaneum miR-3803 stem-loop
Stem-loop
   cacac      a     ---aa     a  u    ----aa   uc 
5'      gaggga uauua     aaugg gg acau      cgu  u
        |||||| |||||     ||||| || ||||      |||   
3'      cucccu guggu     uuacc cc ugua      gcg  g
   accuu      -     caaug     a  -    auaacc   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG10: 1683028-1683112 [+]
intergenic
Database links

Mature sequence tca-miR-3803-5p

Accession MIMAT0018622
Sequence

10 - 

gaauauuaaaaauggaggua

 - 29

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3803-3p

Accession MIMAT0018623
Sequence

51 - 

uaauguccaccauuguaacugguguc

 - 76

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).