Stem-loop sequence tca-mir-3802

AccessionMI0016256 (change log)
DescriptionTribolium castaneum miR-3802 stem-loop
Stem-loop
   cacuu      acuuuau      ---aucaacaaa  u     uu   -   -       ga 
5'      gaugua       acaaaa            ag auggc  gcu uga augacga  u
        ||||||       ||||||            || |||||  ||| ||| |||||||  a
3'      uuauau       uguuuu            uc uaccg  uga gcu uauugcu  a
   auuuu      ---acuu      guaacaucgcug  -     -c   u   a       aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG10: 7113026-7113144 [+]
intergenic
Database links

Mature sequence tca-miR-3802-5p

Accession MIMAT0018620
Sequence

42 - 

uugcuugaaugacgagaua

 - 60

Get sequence
Evidence experimental; SOLID [1]

Mature sequence tca-miR-3802-3p

Accession MIMAT0018621
Sequence

63 - 

aucguuauaucguagucgcc

 - 82

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).