Stem-loop sequence mghv-mir-M1-15

AccessionMI0016255 (change log)
DescriptionMouse gammaherpesvirus 68 miR-M1-15 stem-loop
Stem-loop
     cu     ---c    -cc    u  u 
5' ag  acccg    gugg   ggag gu u
   ||  |||||    ||||   |||| ||  
3' uc  ugggc    cacc   ucuc ca a
     uc     cuuc    caa    c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:U97553.1) Overlapping transcripts
U97553: 5461-5514 [+]
intergenic
Clustered miRNAs
< 10kb from mghv-mir-M1-15
mghv-mir-M1-1U97553: 196-260 [+]
mghv-mir-M1-10U97553: 262-322 [+]
mghv-mir-M1-2U97553: 562-627 [+]
mghv-mir-M1-3U97553: 638-698 [+]
mghv-mir-M1-11U97553: 759-811 [+]
mghv-mir-M1-4U97553: 956-1049 [+]
mghv-mir-M1-5U97553: 1255-1314 [+]
mghv-mir-M1-6U97553: 1319-1381 [+]
mghv-mir-M1-7U97553: 1660-1719 [+]
mghv-mir-M1-12U97553: 1720-1789 [+]
mghv-mir-M1-13U97553: 3749-3808 [+]
mghv-mir-M1-8U97553: 3806-3876 [+]
mghv-mir-M1-14U97553: 5102-5161 [+]
mghv-mir-M1-15U97553: 5461-5514 [+]
mghv-mir-M1-9U97553: 5525-5584 [+]
Database links

Mature sequence mghv-miR-M1-15

Accession MIMAT0018176
Sequence

1 - 

agcuacccgcguggccggaguguuu

 - 25

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).