|
miRBase |
|
Stem-loop sequence mghv-mir-M1-14 |
||||||||||||||||||||||||||||||
| Accession | MI0016254 | |||||||||||||||||||||||||||||
| Description | Mouse gammaherpesvirus 68 miR-M1-14 stem-loop | |||||||||||||||||||||||||||||
| Stem-loop |
gccc g g - ug cguucug augcugugg aca c a ||||||| ||||||||| ||| | a gcaagac ugcgacauc ugu g a uuuu g g c uu |
|||||||||||||||||||||||||||||
| Genome context |
|
|||||||||||||||||||||||||||||
| Clustered miRNAs |
|
|||||||||||||||||||||||||||||
Mature sequence mghv-miR-M1-14-5p |
|
| Accession | MIMAT0018174 |
| Previous IDs | mghv-miR-M1-14* |
| Sequence |
3 - cccguucuggaugcugugggac - 24 |
| Evidence | experimental; 454 [1], Northern [2], RT-PCR [2], Solexa [2] |
Mature sequence mghv-miR-M1-14-3p |
|
| Accession | MIMAT0018175 |
| Previous IDs | mghv-miR-M1-14 |
| Sequence |
38 - ugcuacagcgugcagaacguuu - 59 |
| Evidence | experimental; 454 [1], Northern [1-2], RT-PCR [2], Solexa [2] |
References |
|
| 1 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 2 |
PMID:20660200
"Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts"
J Virol. 84:10344-10353(2010).
|