|
miRBase |
|
Stem-loop sequence tgu-mir-132 |
|||||||||||||||||||||||||||||||||||||||||||
| Accession | MI0016249 | ||||||||||||||||||||||||||||||||||||||||||
| Description | Taeniopygia guttata miR-132 stem-loop | ||||||||||||||||||||||||||||||||||||||||||
| Gene family | MIPF0000065; mir-132 | ||||||||||||||||||||||||||||||||||||||||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours. Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages: You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages. Please note, we're not responsible for the content of Wikipedia pages. You can read more about miRBase, Wikipedia and community annotation on this blog post. Please email us for help or with comments about this community annotation initiative. In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.
In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.
[edit] ExpressionmiR-132 arises from the miR-212/132 cluster located in the intron of a non-coding gene on mouse chromosome 11. The transcription of this cluster was found to be enhanced by the transcription factor CREB (cAMP-response element binding protein). In neuronal cells BDNF (brain derived neurotrophic factor) is known to induce the transcription of this cluster; the pathway is thought to involve the BDNF-mediated activation of ERK1/2, which in turn activates MSK, another kinase enzyme. MSK-mediated phosphorylation of a serine residue on CREB may then enhance production of miR-132. MSK knockout mice still produce miR-132 in response to BDNF, but at a significantly lower level, indicating that there may be an alternative pathway operating.[1] Activators of CREB phosphorylation, for instance forskolin and KSHV binding to endothelial cell targets, can also enhance miR-132 production in vitro. miR-132 levels are increased post-seizure, which strongly suggests a causal relationship between neuronal activation and miR-132 transcription.[2] One example of this phenomenon is in the suprachiasmatic nucleus, where miR-132 is thought be involved in resetting the circadian clock in response to light.[3] Inflammatory mediators such as Lipopolysaccharide (LPS) are also implicated in inducing miR-132 expression. [edit] Role in neuronal cellsmiR-132 is enriched in neuronal cells. Recognition elements for this miRNA have been identified in a number of cellular mRNAs. One such mRNA is that of p250GAP, a GTPase activating protein linked to neuronal differentiation. miR-132 and its recognition site on p250GAP mRNA are highly conserved among vertebrates, and their interaction is suspected to have a role in vertebrate neurogenesis. By decreasing the levels of p250GAP, miR-132 promotes neuronal outgrowth and sprouting.[4] Another target for miR-132 is MeCP2, whose mRNA is expressed as a 'long' variant in neuronal cells. This variant contains a recognition element for miR-132 in its extended 3'UTR. miRNA-132 may be involved in a homeostatic mechanism that regulates MeCP2 levels in the brain. MeCP2 increases the levels of BDNF in the brain, which in turn will increase transcription from the miR-212/132 cluster. An rise in miRNA-132 level will then decrease the levels of MeCP2 and restore the balance. Failure to regulate MeCP2 levels is connected to neurological disorders including Rett syndrome.[5] The role of miR-132 in synaptic function is currently being studied. A BDNF-related increase in miR-132 is thought to bring about an increase in post-synaptic protein levels.[6] miR-132 has been found to associate with Fragile X Mental Retardation Protein FMRP, and may be involved in the selection of mRNAs, including those regulating synaptic function, to undergo translational suppression via an FMRP-dependent mechanism.[7] miR-132 may also be responsible for limiting inflammation in the brain. A recognition sequence for this miRNA can be found in the mRNA for acetylcholinesterase (AChE), that degrades acetylcholine (ACh). By silencing the expression of AChE, ACh levels rise and inhibit peripheral inflammation.[8] [edit] Infection and inflammationOutside the brain, miR-132 can also modulate inflammation; transcription is stimulated by LPS and upregulated at a fairly early stage of herpesvirus infection. KSHV infection of endothelial cells, as well as HSV-1 or HCMV infection of monocytes, have been observed to induce this rise. In this instance the target of translational suppression appears to be p300, a protein that associates with CREB and is an important mediator of antiviral immunity. By decreasing the levels of p300, the expression of IFN-β, ISG15, IL-1β and IL6 is impaired, resulting in the net suppression of antiviral immunity. miR-132 is only transiently induced following infection; the silencing of p300 results in a reduction in CREB-mediated transcription from the miR-212/132 cluster, thus forming a negative feedback loop.[9] Plasma from patients with rheumatoid arthritis (RA) has been found to contain lower levels of miR-132 compared to samples from healthy individuals.[10] As RA is an autoimmune, inflammatory disease, it is possible that miR-132 helps to regulate inflammation in healthy joints. Conversely, miR-132 has been implicated in promoting inflammation in adipocytes. The target for RNA silencing in this case is SirT1, a deacetylase enzyme. The p65 subunit of NF-κB is a SirT1 substrate; in the absence of SirT1 activity, NFκB is active, promoting inflammation and the production of the chemokines IL-8 and MCP-1. This process is implicated in the chronic inflammation that may underlie insulin resistance in the obese, and may occur in response to serum deprivation.[11] [edit] Angiogenesis and cancermiR-132 can induce the proliferation of endothelial cells and has been implicated in neovascularisation. Angiogenic factors such as VEGF and bFGF are CREB activators which could theoretically induce miR-132 production in endothelial cells. Here, the miRNA can silence the expression of p120RasGAP, fixing Ras in a GTP-bound, active conformation so as to induce proliferation.[12] This angiogenic role could implicate miR-132 in oncogenesis, and this miRNA is known to be overexpressed in chronic lymphoblastic leukaemias.[13] miR-132 also comprises part of the recently identified miRNA 'signature' of mammalian osteosarcoma, although a direct role in oncogenesis is yet to be fully described.[14] [edit] Heart pathologyMiR-132 has been found to inhibit cardiac pathology in rodents. [15] [edit] Other targetsThe Angiotensin II receptor type 1 mRNA also undergoes miR-132-mediated silencing.[16] [edit] See also[edit] References
[edit] Further reading
[edit] External links
|
||||||||||||||||||||||||||||||||||||||||||
| Stem-loop |
auccgac --g g u a g
gcc cccgg cgaccguggcu uagau guuacu uucca
||| ||||| ||||||||||| ||||| |||||| |||| c
cgg gggcc gcugguaccga aucug caauga ggggu
gcucaga aca - c a g
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||
Mature sequence tgu-miR-132 |
|
| Accession | MIMAT0018619 |
| Sequence |
57 - uaacagucuacagccauggucg - 78 |
| Evidence | not experimental |
References |
|
| 1 |
PMID:21627805
"Song exposure regulates known and novel microRNAs in the zebra finch auditory forebrain"
Gunaratne PH, Lin YC, Benham AL, Drnevich J, Coarfa C, Tennakoon JB, Creighton CJ, Kim JH, Milosavljevic A, Watson M, Griffiths-Jones S, Clayton DF
BMC Genomics. 12:277(2011).
|
Comments, questions? Email mirbase@manchester.ac.uk