miRNA Entry for MI0016249

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-132

miR-132 microRNA precursor secondary structure and sequence conservation.
Identifiers
Symbol	miR-132
Rfam	RF00662
miRBase family	MIPF0000065
Entrez	406921
HUGO	31516
OMIM	610016
Other data
RNA type	microRNA
Domain(s)	Eukaryota;

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

1 Expression
2 Role in neuronal cells
3 Infection and inflammation
4 Angiogenesis and cancer
5 Heart pathology
6 Other targets
7 See also
8 References
9 Further reading
10 External links

[edit] Expression

miR-132 arises from the miR-212/132 cluster located in the intron of a non-coding gene on mouse chromosome 11. The transcription of this cluster was found to be enhanced by the transcription factor CREB (cAMP-response element binding protein). In neuronal cells BDNF (brain derived neurotrophic factor) is known to induce the transcription of this cluster; the pathway is thought to involve the BDNF-mediated activation of ERK1/2, which in turn activates MSK, another kinase enzyme. MSK-mediated phosphorylation of a serine residue on CREB may then enhance production of miR-132. MSK knockout mice still produce miR-132 in response to BDNF, but at a significantly lower level, indicating that there may be an alternative pathway operating.^[1] Activators of CREB phosphorylation, for instance forskolin and KSHV binding to endothelial cell targets, can also enhance miR-132 production in vitro. miR-132 levels are increased post-seizure, which strongly suggests a causal relationship between neuronal activation and miR-132 transcription.^[2] One example of this phenomenon is in the suprachiasmatic nucleus, where miR-132 is thought be involved in resetting the circadian clock in response to light.^[3] Inflammatory mediators such as Lipopolysaccharide (LPS) are also implicated in inducing miR-132 expression.

[edit] Role in neuronal cells

miR-132 is enriched in neuronal cells. Recognition elements for this miRNA have been identified in a number of cellular mRNAs. One such mRNA is that of p250GAP, a GTPase activating protein linked to neuronal differentiation. miR-132 and its recognition site on p250GAP mRNA are highly conserved among vertebrates, and their interaction is suspected to have a role in vertebrate neurogenesis. By decreasing the levels of p250GAP, miR-132 promotes neuronal outgrowth and sprouting.^[4]

Another target for miR-132 is MeCP2, whose mRNA is expressed as a 'long' variant in neuronal cells. This variant contains a recognition element for miR-132 in its extended 3'UTR. miRNA-132 may be involved in a homeostatic mechanism that regulates MeCP2 levels in the brain. MeCP2 increases the levels of BDNF in the brain, which in turn will increase transcription from the miR-212/132 cluster. An rise in miRNA-132 level will then decrease the levels of MeCP2 and restore the balance. Failure to regulate MeCP2 levels is connected to neurological disorders including Rett syndrome.^[5]

The role of miR-132 in synaptic function is currently being studied. A BDNF-related increase in miR-132 is thought to bring about an increase in post-synaptic protein levels.^[6] miR-132 has been found to associate with Fragile X Mental Retardation Protein FMRP, and may be involved in the selection of mRNAs, including those regulating synaptic function, to undergo translational suppression via an FMRP-dependent mechanism.^[7]

miR-132 may also be responsible for limiting inflammation in the brain. A recognition sequence for this miRNA can be found in the mRNA for acetylcholinesterase (AChE), that degrades acetylcholine (ACh). By silencing the expression of AChE, ACh levels rise and inhibit peripheral inflammation.^[8]

[edit] Infection and inflammation

Outside the brain, miR-132 can also modulate inflammation; transcription is stimulated by LPS and upregulated at a fairly early stage of herpesvirus infection. KSHV infection of endothelial cells, as well as HSV-1 or HCMV infection of monocytes, have been observed to induce this rise. In this instance the target of translational suppression appears to be p300, a protein that associates with CREB and is an important mediator of antiviral immunity. By decreasing the levels of p300, the expression of IFN-β, ISG15, IL-1β and IL6 is impaired, resulting in the net suppression of antiviral immunity. miR-132 is only transiently induced following infection; the silencing of p300 results in a reduction in CREB-mediated transcription from the miR-212/132 cluster, thus forming a negative feedback loop.^[9]

Plasma from patients with rheumatoid arthritis (RA) has been found to contain lower levels of miR-132 compared to samples from healthy individuals.^[10] As RA is an autoimmune, inflammatory disease, it is possible that miR-132 helps to regulate inflammation in healthy joints.

Conversely, miR-132 has been implicated in promoting inflammation in adipocytes. The target for RNA silencing in this case is SirT1, a deacetylase enzyme. The p65 subunit of NF-κB is a SirT1 substrate; in the absence of SirT1 activity, NFκB is active, promoting inflammation and the production of the chemokines IL-8 and MCP-1. This process is implicated in the chronic inflammation that may underlie insulin resistance in the obese, and may occur in response to serum deprivation.^[11]

[edit] Angiogenesis and cancer

miR-132 can induce the proliferation of endothelial cells and has been implicated in neovascularisation. Angiogenic factors such as VEGF and bFGF are CREB activators which could theoretically induce miR-132 production in endothelial cells. Here, the miRNA can silence the expression of p120RasGAP, fixing Ras in a GTP-bound, active conformation so as to induce proliferation.^[12] This angiogenic role could implicate miR-132 in oncogenesis, and this miRNA is known to be overexpressed in chronic lymphoblastic leukaemias.^[13] miR-132 also comprises part of the recently identified miRNA 'signature' of mammalian osteosarcoma, although a direct role in oncogenesis is yet to be fully described.^[14]

[edit] Heart pathology

MiR-132 has been found to inhibit cardiac pathology in rodents. ^[15]

[edit] Other targets

The Angiotensin II receptor type 1 mRNA also undergoes miR-132-mediated silencing.^[16]

[edit] See also

MicroRNA

[edit] References

^ Remenyi J, Hunter CJ, Cole C, Ando H, Impey S, Monk CE, Martin KJ, Barton GJ, Hutvagner G, Arthur JS (2010). "Regulation of the miR-212/132 locus by MSK1 and CREB in response to neurotrophins". Biochem J. 428 (2): 281–91. doi:10.1042/BJ20100024. PMID 20307261.
^ Nudelman AS, DiRocco DP, Lambert TJ, Garelick MG, Le J, Nathanson NM, Storm DR (2010). "Neuronal activity rapidly induces transcription of the CREB-regulated microRNA-132, in vivo". Hippocampus 20 (4): 492–8. doi:10.1002/hipo.20646. PMC 2847008. PMID 19557767. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2847008/.
^ Cheng HY, Papp JW, Varlamova O, Dziema H, Russell B, Curfman JP, Nakazawa T, Shimizu K, Okamura H, Impey S, Obrietan K (2007). "microRNA modulation of circadian-clock period and entrainment". Neuron 54 (5): 813–29. doi:10.1016/j.neuron.2007.05.017. PMC 2590749. PMID 17553428. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2590749/.
^ Vo N, Klein ME, Varlamova O, Keller DM, Yamamoto T, Goodman RH, Impey S (2005). "A cAMP-response element binding protein-induced microRNA regulates neuronal morphogenesis". Proc Natl Acad Sci USA 102 (45): 16426–31. doi:10.1073/pnas.0508448102. PMC 1283476. PMID 16260724. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1283476/.
^ Klein ME, Lioy DT, Ma L, Impey S, Mandel G, Goodman RH (2007). "Homeostatic regulation of MeCP2 expression by a CREB-induced microRNA". Nat Neurosci 10 (12): 1513–4. doi:10.1038/nn2010. PMID 17994015.
^ Kawashima H, Numakawa T, Kumamaru E, Adachi N, Mizuno H, Ninomiya M, Kunugi H, Hashido K (2010). "Glucocorticoid attenuates brain-derived neurotrophic factor-dependent upregulation of glutamate receptors via the suppression of microRNA-132 expression". Neuroscience 165 (4): 1301–11. doi:10.1016/j.neuroscience.2009.11.057. PMID 19958814.
^ Edbauer D, Neilson JR, Foster KA, Wang CF, Seeburg DP, Batterton MN, Tada T, Dolan BM, Sharp PA, Sheng M (2010). "Regulation of synaptic structure and function by FMRP-associated microRNAs miR-125b and miR-132". Neuron 65 (3): 373–84. doi:10.1016/j.neuron.2010.01.005. PMID 20159450.
^ Shaked I, Meerson A, Wolf Y, Avni R, Greenberg D, Gilboa-Geffen A, Soreq H (2009). "MicroRNA-132 potentiates cholinergic anti-inflammatory signaling by targeting acetylcholinesterase". Immunity 31 (6): 965–73. doi:10.1016/j.immuni.2009.09.019. PMID 20005135.
^ Lagos D, Pollara G, Henderson S, Gratrix F, Fabani M, Milne RS, Gotch F, Boshoff C (2010). "miR-132 regulates antiviral innate immunity through suppression of the p300 transcriptional co-activator". Nat Cell Biol 12 (5): 513–9. doi:10.1038/ncb2054. PMID 20418869.
^ Murata K, Yoshitomi H, Tanida S, Ishikawa M, Nishitani K, Ito H, Nakamura T (2010). "Plasma and synovial fluid microRNAs as potential biomarkers of rheumatoid arthritis and osteoarthritis". Arthritis Res Ther 12 (3): R86. doi:10.1186/ar3013. PMC 2911870. PMID 20470394. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2911870/.
^ Strum JC, Johnson JH, Ward J, Xie H, Feild J, Hester A, Alford A, Waters KM (2009). "MicroRNA 132 regulates nutritional stress-induced chemokine production through repression of SirT1". Mol Endocrinol 23 (11): 1876–84. doi:10.1210/me.2009-0117. PMID 19819989.
^ Anand S, Majeti BK, Acevedo LM, Murphy EA, Mukthavaram R, Scheppke L, Huang M, Shields DJ, Lindquist JN, Lapinski PE, King PD, Weis SM, Cheresh DA (2010). "MicroRNA-132-mediated loss of p120RasGAP activates the endothelium to facilitate pathological angiogenesis". Nat Med 16 (8): 909–14. doi:10.1038/nm.2186. PMC 3094020. PMID 20676106. //www.ncbi.nlm.nih.gov/pmc/articles/PMC3094020/.
^ Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, Shimizu M, Cimmino A, Zupo S, Dono M, Dell'Aquila ML, Alder H, Rassenti L, Kipps TJ, Bullrich F, Negrini M, Croce CM (2004). "MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias". Proc Natl Acad Sci U S A. 101 (32): 11755–60. doi:10.1073/pnas.0404432101. PMC 511048. PMID 15284443. //www.ncbi.nlm.nih.gov/pmc/articles/PMC511048/.
^ Gougelet A, Pissaloux D, Besse A, Perez J, Duc A, Dutour A, Blay JY, Alberti L (2010). "miRNA profiles in osteosarcoma as a predictive tool for ifosfamide response". Int J Cancer 129 (3): 680–690. doi:10.1002/ijc.25715. PMID 20949564.
^ http://medicalxpress.com/news/2012-09-heart-failure-mice.html
^ Elton TS, Kuhn DE, Malana GE, Martin MM, Nuovo GJ, Pleister AP, Feldman DS (2007). "MiR-132 Regulates Angiotensin II Type 1 Receptor Expression Through a Protein Coding Region Binding Site". Circulation 118 (18): S513.

[edit] Further reading

^ Magill ST, Cambronne XA, Luikart BW, Lioy DT, Leighton BH, Westbrook GL, Mandel G, Goodman RH (2010). "microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus". Proc Natl Acad Sci U S A 107 (47): 20382–7. doi:10.1073/pnas.1015691107. PMC 2996687. PMID 21059906. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2996687/.
^ Cheng HY, Obrietan K (2007). "Revealing a role of microRNAs in the regulation of the biological clock". Cell Cycle 6 (24): 3034–5. doi:10.4161/cc.6.24.5106. PMID 18075311.
^ Schratt G (2009). "microRNAs at the synapse". Nat Rev Neurosci 10 (12): 842–9. doi:10.1038/nrn2763. PMID 19888283.
^ Miller BH, Wahlestedt C (2010). "MicroRNA dysregulation in psychiatric disease". Brain Res 1338: 89–99. doi:10.1016/j.brainres.2010.03.035. PMC 2891055. PMID 20303342. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2891055/.
^ O'Neill LA (2009). "Boosting the brain's ability to block inflammation via microRNA-132". Immunity 31 (6): 854–5. doi:10.1016/j.immuni.2009.11.004. PMID 20064444.

[edit] External links

Page for mir-132 microRNA precursor family at Rfam

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

Mature sequence tgu-miR-132
Accession	MIMAT0018619
Sequence	57 - uaacagucuacagccauggucg - 78 Get sequence
Evidence	not experimental

miRBase

Stem-loop sequence tgu-mir-132

Contents