Stem-loop sequence ame-mir-750

AccessionMI0016245 (change log)
DescriptionApis mellifera miR-750 stem-loop
Literature search

1 open access papers mention ame-mir-750
(1 sentences)

Stem-loop
   ggg    gcau   cu      u   u     gc         -uga      a    -  -----    ag 
5'    cguu    gga  gugauc gca gacuu  aguuggaag    ggaucu ggca gu     gagc  c
      ||||    |||  |||||| ||| |||||  |||||||||    |||||| |||| ||     ||||   
3'    gcaa    ucu  uauuag ugu cugga  ucgaccuuc    ucuaga ccgu ca     cucg  a
   --a    accc   ac      u   u     ac         ucaa      -    u  auagu    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
GL631151.1: 1934-2069 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-750
ame-mir-750GL631151.1: 1934-2069 [+]
ame-mir-1175GL631151.1: 2090-2227 [+]
Database links

Mature sequence ame-miR-750-3p

Accession MIMAT0018615
Sequence

84 - 

ccagaucuaacucuuccagcuc

 - 105

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).