Stem-loop sequence ame-mir-306

AccessionMI0016209 (change log)
DescriptionApis mellifera miR-306 stem-loop
Literature search

2 open access papers mention ame-mir-306
(4 sentences)

Stem-loop
   aa     u    aag  -caaaca           u  c      ug   ga  c      uaca 
5'   uucag aagu   gu       aauauuuacuu gu agguac  agu  cu ugagua    u
     ||||| ||||   ||       ||||||||||| || ||||||  |||  || ||||||     
3'   aaguu uuua   ca       uuauaggugag ca uccaug  ucg  ga acucau    u
   -a     -    --a  acauaag           u  a      gu   ac  a      uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 7887398-7887524 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-306
ame-mir-306CM000066.5: 7887398-7887524 [+]
ame-mir-79CM000066.5: 7887622-7887721 [+]
ame-mir-9bCM000066.5: 7887633-7887724 [-]
Database links

Mature sequence ame-miR-306-5p

Accession MIMAT0018579
Sequence

37 - 

ucagguacugagugacucugag

 - 58

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).