Stem-loop sequence ame-mir-9c

AccessionMI0016202 (change log)
DescriptionApis mellifera miR-9c stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   gcu      --        -uaccaaauc   c  uu      u     g       a  g      gaau 
5'    guuuca  cacauuuc          guc cg  uauuuu cuuug ugagcua cu uauggu    u
      ||||||  ||||||||          ||| ||  |||||| ||||| ||||||| || ||||||     
3'    uaaagu  guguaaag          cag gc  auagaa ggaac acuugau ga auaccg    g
   --u      ca        uacuucgaua   a  uu      c     g       c  a      gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 1395236-1395374 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-9c
ame-mir-3478CM000066.5: 1395549-1395626 [+]
ame-mir-3791CM000066.5: 1395544-1395636 [-]
ame-mir-279bCM000066.5: 1395401-1395527 [-]
ame-mir-9cCM000066.5: 1395236-1395374 [-]
ame-mir-2944CM000066.5: 1395048-1395172 [-]
ame-mir-318CM000066.5: 1394890-1395007 [-]
Database links

Mature sequence ame-miR-9c-3p

Accession MIMAT0018572
Sequence

79 - 

uaaagcuaguucagcaaggca

 - 99

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).