Stem-loop sequence ame-mir-3716b

AccessionMI0016192 (change log)
DescriptionApis mellifera miR-3716b stem-loop
Stem-loop
   c     ugaa    aa  acu   a     -     a    ucua      uu     ug 
5'  aaacu    auug  ga   uga uucga uggca ucgu    uguauu  ugcaa  u
    |||||    ||||  ||   ||| ||||| ||||| ||||    ||||||  |||||  a
3'  uuuga    uaac  uu   acu aaguu auugu agca    acauag  acguu  u
   a     -uaa    gg  ---   a     u     -    -uua      --     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 569652-569765 [+]
intergenic
Database links

Mature sequence ame-miR-3716b-3p

Accession MIMAT0018562
Sequence

80 - 

cgauguuauuugaaaucauuggc

 - 102

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).