Stem-loop sequence ame-mir-3721

AccessionMI0016176 (change log)
DescriptionApis mellifera miR-3721 stem-loop
Stem-loop
   --------ugaauc       au  a       cac     -  -agaaa       a 
5'               gagcauu  uu cuccuuu   uucga ga      aauaaaa a
                 |||||||  || |||||||   ||||| ||      ||||||| g
3'               cucguag  aa gaggaga   aaguu cu      uuauuuu a
   uuaauuacuaccuc       --  -       -aa     g  agacac       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 7789081-7789185 [-]
intergenic
Database links

Mature sequence ame-miR-3721-3p

Accession MIMAT0018546
Sequence

66 - 

ucguugaaaaagaggagaagau

 - 87

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).