Stem-loop sequence ame-mir-3770

AccessionMI0016175 (change log)
DescriptionApis mellifera miR-3770 stem-loop
Literature search

1 open access papers mention ame-mir-3770
(2 sentences)

Stem-loop
   -c       aug     a       auca           --    uu 
5'   aacgcac   gacgc auccugc    agugcguuguu  uugu  u
     |||||||   ||||| |||||||    |||||||||||  ||||   
3'   uugugug   uugug uaggacg    uuacguaacga  aaua  u
   ga       --a     a       aaug           cu    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 14555068-14555160 [-]
intergenic
Database links

Mature sequence ame-miR-3770-5p

Accession MIMAT0018545
Sequence

17 - 

aauccugcaucaagugcguugu

 - 38

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).