Stem-loop sequence ame-mir-971

AccessionMI0016174 (change log)
DescriptionApis mellifera miR-971 stem-loop
Gene family MIPF0000995; mir-971
Literature search

1 open access papers mention ame-mir-971
(2 sentences)

Stem-loop
   gga ag    aga a   g     ac   ggc  gu     u    uuc           c   cu 
5'    g  ggag   g cga gaugc  cgg   cg  ucacu uaag   gaauaccaagc ugu  a
      |  ||||   | ||| |||||  |||   ||  ||||| ||||   ||||||||||| |||   
3'    c  ccuu   c gcu cuaug  gcc   gc  aguga auuc   cuugugguuug aca  u
   --a aa    --g a   g     gu   --a  ug     c    cau           -   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000068.5: 3886573-3886699 [-]
intergenic
Database links

Mature sequence ame-miR-971-3p

Accession MIMAT0018544
Sequence

76 - 

uugguguucuaccuuacagugag

 - 98

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).