Stem-loop sequence ame-mir-3049

AccessionMI0016158 (change log)
DescriptionApis mellifera miR-3049 stem-loop
Literature search

1 open access papers mention ame-mir-3049
(2 sentences)

Stem-loop
   u c     uaaaagcaauu    -     uc     u        u     c         gguca 
5'  g aggag           gaau cgugu  ccagg cgggaagg aguug ggcggauuu     a
    | |||||           |||| |||||  ||||| |||||||| ||||| |||||||||      
3'  c uccuc           cuua gcgcg  gguuc gccuuucc ucaac cugccugaa     c
   u c     -----------    a     gu     u        -     -         aacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000063.5: 3983815-3983934 [+]
intergenic
Database links

Mature sequence ame-miR-3049-5p

Accession MIMAT0022968
Sequence

36 - 

ucgggaagguaguugcggcggau

 - 58

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence ame-miR-3049-3p

Accession MIMAT0018528
Previous IDsame-miR-3049
Sequence

76 - 

uccguccaacuccuuuccgucu

 - 97

Get sequence
Evidence experimental; SOLID [1], Illumina [4]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
4
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).