Stem-loop sequence ame-mir-3745

AccessionMI0016143 (change log)
DescriptionApis mellifera miR-3745 stem-loop
Stem-loop
   g   g     --    u     -  acaguu    a  gu   a   guu      cc ucc 
5'  cac ccggg  gggg guggu cc      gguu cg  gaa cgg   uggcca  g   c
    ||| |||||  |||| ||||| ||      |||| ||  ||| |||   ||||||  |   c
3'  gug ggccc  cccc caccg gg      ccga gc  cuu guc   gccggu  c   c
   a   -     gg    c     u  ----gc    -  ug   a   ---      cu uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 9847888-9848002 [+]
intergenic
Database links

Mature sequence ame-miR-3745-3p

Accession MIMAT0018513
Sequence

90 - 

cgggugccaccccccggcccgg

 - 111

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).