Stem-loop sequence ame-mir-989

AccessionMI0016141 (change log)
DescriptionApis mellifera miR-989 stem-loop
Literature search

1 open access papers mention ame-mir-989
(1 sentences)

Stem-loop
   c        --  --     uaa  a         a  g   g   -a c 
5'  agaaucac  cg  auauu   gu uggguggag ga cgg gag  g a
    ||||||||  ||  |||||   || ||||||||| || ||| |||  |  
3'  ucuuggug  gc  uguag   cg gcccgccuc cu gcu cuu  c a
   c        au  ag     -ug  -         -  -   g   ag a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 14359909-14360001 [-]
intergenic
Database links

Mature sequence ame-miR-989-3p

Accession MIMAT0018511
Sequence

71 - 

cgugaugugacguagugguucu

 - 92

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).