Stem-loop sequence ame-mir-193

AccessionMI0016138 (change log)
DescriptionApis mellifera miR-193 stem-loop
Literature search

1 open access papers mention ame-mir-193
(1 sentences)

Stem-loop
   agg    a  a    guaaaug         g       c     ug u  u    u  cug g 
5'    gucg ag guga       gccgagggu auuuggg cuuag  g cc gugg gg   c u
      |||| || ||||       ||||||||| ||||||| |||||  | || |||| ||   |  
3'    uagc uc cgcu       cggcucuua ugaaccc gaauc  c gg cauc cu   g a
   --a    g  g    -------         g       u     gu c  u    -  -aa c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 204902-205020 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-193
ame-mir-193CM000054.5: 204902-205020 [+]
ame-mir-2788CM000054.5: 211099-211205 [+]
Database links

Mature sequence ame-miR-193-3p

Accession MIMAT0018508
Sequence

74 - 

uacuggccugcuaagucccaa

 - 94

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).