Stem-loop sequence ame-mir-1175

AccessionMI0016137 (change log)
DescriptionApis mellifera miR-1175 stem-loop
Gene family MIPF0000715; mir-1175
Literature search

1 open access papers mention ame-mir-1175
(1 sentences)

Stem-loop
   caa          --------u   c     ----        u  uuc    -    a     -   uua         
5'    aaauaaauaa         aug aagaa    agggauua gg   aagu ggag agugg ucu   cgcuuuga 
      ||||||||||         ||| |||||    |||||||| ||   |||| |||| ||||| |||   ||||||| a
3'    uuuguuuauu         ugc uucuu    ucccuagu cc   uuca ccuc ucacu aga   gugaaauu 
   --c          uuuuuuuuu   -     auaa        -  uca    a    c     u   ---         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
GL631151.1: 2090-2227 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-1175
ame-mir-750GL631151.1: 1934-2069 [+]
ame-mir-1175GL631151.1: 2090-2227 [+]
Database links

Mature sequence ame-miR-1175-3p

Accession MIMAT0018507
Sequence

73 - 

ugagauucacuccuccaacuuac

 - 95

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).