Stem-loop sequence hsa-mir-3691

Accession MI0016092
Description Homo sapiens miR-3691 stem-loop
Stem-loop 
u            u  u        g     c   a      gc 
 ugaggcacuggg ag ggaugaug agacu ggu cccacu  u
 |||||||||||| || |||||||| ||||| ||| ||||||   
 acuccgugacuc uc ccuacugc ucuga cca gggugg  g
a            c  u        g     a   g      ga
Get sequence
Deep sequencing
5 reads, 3 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 5148467-5148556 [-]
sense
OTTHUMT00000353482 ; LYRM4-004; intron 1
OTTHUMT00000353482 ; LYRM4-004; intron 1
OTTHUMT00000353482 ; LYRM4-004; intron 1
OTTHUMT00000353483 ; LYRM4-005; intron 2
OTTHUMT00000353484 ; LYRM4-006; intron 2
OTTHUMT00000353485 ; LYRM4-007; intron 2
OTTHUMT00000353461 ; LYRM4-001; intron 2
OTTHUMT00000353483 ; LYRM4-005; intron 2
OTTHUMT00000353484 ; LYRM4-006; intron 2
OTTHUMT00000353485 ; LYRM4-007; intron 2
OTTHUMT00000353461 ; LYRM4-001; intron 2
OTTHUMT00000353483 ; LYRM4-005; intron 2
OTTHUMT00000353484 ; LYRM4-006; intron 2
OTTHUMT00000353485 ; LYRM4-007; intron 2
OTTHUMT00000353461 ; LYRM4-001; intron 2
ENST00000468929 ; LYRM4-004; intron 1
ENST00000468929 ; LYRM4-004; intron 1
ENST00000468929 ; LYRM4-004; intron 1
ENST00000330636 ; LYRM4-001; intron 2
ENST00000464010 ; LYRM4-006; intron 2
ENST00000463032 ; LYRM4-007; intron 2
ENST00000480566 ; LYRM4-005; intron 2
ENST00000330636 ; LYRM4-001; intron 2
ENST00000464010 ; LYRM4-006; intron 2
ENST00000463032 ; LYRM4-007; intron 2
ENST00000480566 ; LYRM4-005; intron 2
ENST00000330636 ; LYRM4-001; intron 2
ENST00000464010 ; LYRM4-006; intron 2
ENST00000463032 ; LYRM4-007; intron 2
ENST00000480566 ; LYRM4-005; intron 2
Database links

Mature sequence hsa-miR-3691-5p

Accession MIMAT0018120
Previous IDs hsa-miR-3691
Sequence

15 -  

aguggaugauggagacucgguac

 - 37

Get sequence
Deep sequencing 5 reads, 3 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

Mature sequence hsa-miR-3691-3p

Accession MIMAT0019224
Sequence

56 -  

accaagucugcgucauccucuc

 - 77

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).