Stem-loop sequence hsa-mir-3690-1

Accession MI0016091
Previous IDs hsa-mir-3690
Description Homo sapiens miR-3690-1 stem-loop
Gene family MIPF0001618; mir-3690
Stem-loop 
       c   c   ac    c     caaa   gug 
cccaucu cac ugg  ccag guaga    gag   u
||||||| ||| |||  |||| |||||    |||   u
ggguaga gug acc  gguc caucu    cuc   u
       u   -   ca    -     auac   auc
Get sequence
Deep sequencing
319 reads, 6 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 1412811-1412885 [+]
sense
OTTHUMT00000035807 ; CSF2RA-016; intron 1
OTTHUMT00000035807 ; CSF2RA-016; intron 1
OTTHUMT00000035807 ; CSF2RA-016; intron 1
OTTHUMT00000035798 ; CSF2RA-007; intron 5
OTTHUMT00000035803 ; CSF2RA-012; intron 5
OTTHUMT00000035798 ; CSF2RA-007; intron 5
OTTHUMT00000035803 ; CSF2RA-012; intron 5
OTTHUMT00000035798 ; CSF2RA-007; intron 5
OTTHUMT00000035803 ; CSF2RA-012; intron 5
OTTHUMT00000035799 ; CSF2RA-008; intron 6
OTTHUMT00000035800 ; CSF2RA-009; intron 6
OTTHUMT00000035799 ; CSF2RA-008; intron 6
OTTHUMT00000035800 ; CSF2RA-009; intron 6
OTTHUMT00000035799 ; CSF2RA-008; intron 6
OTTHUMT00000035800 ; CSF2RA-009; intron 6
OTTHUMT00000035013 ; CSF2RA-001; intron 7
OTTHUMT00000035014 ; CSF2RA-002; intron 7
OTTHUMT00000035015 ; CSF2RA-003; intron 7
OTTHUMT00000035016 ; CSF2RA-004; intron 7
OTTHUMT00000035017 ; CSF2RA-005; intron 7
OTTHUMT00000035797 ; CSF2RA-006; intron 7
OTTHUMT00000035013 ; CSF2RA-001; intron 7
OTTHUMT00000035014 ; CSF2RA-002; intron 7
OTTHUMT00000035015 ; CSF2RA-003; intron 7
OTTHUMT00000035016 ; CSF2RA-004; intron 7
OTTHUMT00000035017 ; CSF2RA-005; intron 7
OTTHUMT00000035797 ; CSF2RA-006; intron 7
OTTHUMT00000035013 ; CSF2RA-001; intron 7
OTTHUMT00000035014 ; CSF2RA-002; intron 7
OTTHUMT00000035015 ; CSF2RA-003; intron 7
OTTHUMT00000035016 ; CSF2RA-004; intron 7
OTTHUMT00000035017 ; CSF2RA-005; intron 7
OTTHUMT00000035797 ; CSF2RA-006; intron 7
ENST00000475259 ; CSF2RA-016; intron 1
ENST00000475259 ; CSF2RA-016; intron 1
ENST00000475259 ; CSF2RA-016; intron 1
ENST00000494969 ; CSF2RA-012; intron 5
ENST00000381500 ; CSF2RA-007; intron 5
ENST00000417535 ; CSF2RA-203; intron 5
ENST00000501036 ; CSF2RA-205; intron 5
ENST00000494969 ; CSF2RA-012; intron 5
ENST00000381500 ; CSF2RA-007; intron 5
ENST00000417535 ; CSF2RA-203; intron 5
ENST00000501036 ; CSF2RA-205; intron 5
ENST00000494969 ; CSF2RA-012; intron 5
ENST00000381500 ; CSF2RA-007; intron 5
ENST00000417535 ; CSF2RA-202; intron 5
ENST00000501036 ; CSF2RA-204; intron 5
ENST00000493312 ; CSF2RA-008; intron 6
ENST00000412290 ; CSF2RA-009; intron 6
ENST00000493312 ; CSF2RA-008; intron 6
ENST00000412290 ; CSF2RA-009; intron 6
ENST00000493312 ; CSF2RA-008; intron 6
ENST00000412290 ; CSF2RA-009; intron 6
ENST00000381529 ; CSF2RA-006; intron 7
ENST00000381524 ; CSF2RA-001; intron 7
ENST00000381509 ; CSF2RA-005; intron 7
ENST00000355805 ; CSF2RA-002; intron 7
ENST00000486791 ; CSF2RA-003; intron 7
ENST00000355432 ; CSF2RA-004; intron 7
ENST00000361536 ; CSF2RA-201; intron 7
ENST00000381507 ; CSF2RA-202; intron 7
ENST00000381529 ; CSF2RA-006; intron 7
ENST00000381524 ; CSF2RA-001; intron 7
ENST00000381509 ; CSF2RA-005; intron 7
ENST00000355805 ; CSF2RA-002; intron 7
ENST00000486791 ; CSF2RA-003; intron 7
ENST00000355432 ; CSF2RA-004; intron 7
ENST00000361536 ; CSF2RA-201; intron 7
ENST00000381507 ; CSF2RA-202; intron 7
ENST00000381529 ; CSF2RA-006; intron 7
ENST00000381524 ; CSF2RA-001; intron 7
ENST00000381509 ; CSF2RA-005; intron 7
ENST00000355805 ; CSF2RA-002; intron 7
ENST00000486791 ; CSF2RA-003; intron 7
ENST00000355432 ; CSF2RA-004; intron 7
ENST00000361536 ; CSF2RA-201; intron 7
ENST00000432318 ; CSF2RA-204; intron 8
ENST00000432318 ; CSF2RA-204; intron 8
ENST00000432318 ; CSF2RA-203; intron 8
Database links

Mature sequence hsa-miR-3690

Accession MIMAT0018119
Sequence

10 -  

accuggacccagcguagacaaag

 - 32

Get sequence
Deep sequencing 319 reads, 6 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).