Stem-loop sequence hsa-mir-3689a

AccessionMI0016090 (change log)
Symbol HGNC:MIR3689A
DescriptionHomo sapiens miR-3689a stem-loop
Gene family MIPF0001144; mir-3689
Literature search

1 open access papers mention hsa-mir-3689a
(1 sentences)

Stem-loop
     ug    g gu         g    ug     ug ga 
5' cc  ggag u  gauaucaug uucc  ggagg  u  u
   ||  |||| |  ||||||||| ||||  |||||  |   
3' gg  ccuu g  cuauagugu gagg  ccuuc  g  c
     gu    g ug         g    gu     gu uc 
Get sequence
Deep sequencing
160 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 134849487-134849564 [-]
sense
OTTHUMT00000054771 ; MED27-002; intron 3
OTTHUMT00000054770 ; MED27-001; intron 3
ENST00000357028 ; MED27-002; intron 3
ENST00000292035 ; MED27-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-3689a
hsa-mir-3689fchr9: 134850742-134850807 [-]
hsa-mir-3689echr9: 134850570-134850641 [-]
hsa-mir-3689d-2chr9: 134850277-134850356 [-]
hsa-mir-3689bchr9: 134850125-134850272 [-]
hsa-mir-3689d-1chr9: 134849609-134849682 [-]
hsa-mir-3689achr9: 134849487-134849564 [-]
hsa-mir-3689cchr9: 134849298-134849369 [-]
Database links

Mature sequence hsa-miR-3689a-5p

Accession MIMAT0018117
Sequence

10 - 

ugugauaucaugguuccuggga

 - 31

Get sequence
Deep sequencing109 reads, 13 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-3689a-3p

Accession MIMAT0018118
Sequence

50 - 

cugggaggugugauaucguggu

 - 71

Get sequence
Deep sequencing43 reads, 7 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).