|
miRBase |
|
Stem-loop sequence hsa-mir-3688-1 |
||||||
| Accession | MI0016089 | |||||
| Previous IDs | hsa-mir-3688 | |||||
| Description | Homo sapiens miR-3688-1 stem-loop | |||||
| Gene family | MIPF0001263; mir-3688 | |||||
| Stem-loop |
c au ugua ucuucacuuu aagaguggcaaagucuuuccauaugu gua u |||||||||| |||||||||||||||||||||||||| ||| g agaagugaaa uucucaccguuucagaaagguauaca cau u u -- uguc |
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence hsa-miR-3688-5p |
|
| Accession | MIMAT0019223 |
| Sequence |
15 - aguggcaaagucuuuccauau - 35 |
| Evidence | experimental; Solexa [2] |
| Predicted targets |
|
Mature sequence hsa-miR-3688-3p |
|
| Accession | MIMAT0018116 |
| Previous IDs | hsa-miR-3688 |
| Sequence |
60 - uauggaaagacuuugccacucu - 81 |
| Deep sequencing | 22 reads, 6 experiments |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20459673
"Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood"
BMC Genomics. 11:288(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|