Stem-loop sequence hsa-mir-3684

Accession

MI0016085

Description

Homo sapiens miR-3684 stem-loop

Stem-loop

            c                  uugag 
aaucuaaaggac uguacuagguuuaacaug     c
|||||||||||| ||||||||||||||||||      
uuagauuuccug acaugauccagauuguac     a
            c                  ucauu 

Genome context

• Coordinates (GRCh37.p5): chr4: 99918538-99918611 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000364237 ; METAP1-001; intron 1

  OTTHUMT00000364239 ; METAP1-003; intron 1

  OTTHUMT00000364240 ; METAP1-004; intron 1

  OTTHUMT00000364241 ; METAP1-005; intron 1

  OTTHUMT00000364242 ; METAP1-006; intron 1

  OTTHUMT00000364243 ; METAP1-007; intron 1

  OTTHUMT00000364237 ; METAP1-001; intron 1

  OTTHUMT00000364239 ; METAP1-003; intron 1

  OTTHUMT00000364240 ; METAP1-004; intron 1

  OTTHUMT00000364241 ; METAP1-005; intron 1

  OTTHUMT00000364242 ; METAP1-006; intron 1

  OTTHUMT00000364243 ; METAP1-007; intron 1

  OTTHUMT00000364237 ; METAP1-001; intron 1

  OTTHUMT00000364239 ; METAP1-003; intron 1

  OTTHUMT00000364240 ; METAP1-004; intron 1

  OTTHUMT00000364241 ; METAP1-005; intron 1

  OTTHUMT00000364242 ; METAP1-006; intron 1

  OTTHUMT00000364243 ; METAP1-007; intron 1

  ENST00000296411 ; METAP1-001; intron 1

  ENST00000510209 ; METAP1-003; intron 1

  ENST00000507537 ; METAP1-004; intron 1

  ENST00000506238 ; METAP1-005; intron 1

  ENST00000503247 ; METAP1-006; intron 1

  ENST00000510107 ; METAP1-007; intron 1

  ENST00000296411 ; METAP1-001; intron 1

  ENST00000510209 ; METAP1-003; intron 1

  ENST00000507537 ; METAP1-004; intron 1

  ENST00000506238 ; METAP1-005; intron 1

  ENST00000503247 ; METAP1-006; intron 1

  ENST00000510107 ; METAP1-007; intron 1

  ENST00000296411 ; METAP1-001; intron 1

  ENST00000510209 ; METAP1-003; intron 1

  ENST00000507537 ; METAP1-004; intron 1

  ENST00000506238 ; METAP1-005; intron 1

  ENST00000503247 ; METAP1-006; intron 1

  ENST00000510107 ; METAP1-007; intron 1

Database links

• ENTREZGENE: 100500867;MIR3684

Mature sequence hsa-miR-3684

• Accession: MIMAT0018112
• Sequence: 48 - uuagaccuaguacacguccuu - 68
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3684
  • MIRDB:hsa-miR-3684
  • RNA22-HSA:hsa-miR-3684
  • TARGETMINER:hsa-miR-3684

References

1. PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).