Stem-loop sequence hsa-mir-3682

Accession

MI0016083

Description

Homo sapiens miR-3682 stem-loop

Stem-loop

            g                       a   a 
uaaguuauauau ucuacuucuaccuguguuaucau aua a
|||||||||||| ||||||||||||||||||||||| |||  
auucaauauaua agauggagguggacauaguagua ugu g
            a                       c   g 

Genome context

• Coordinates (GRCh37.p5): chr2: 54076259-54076342 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000324080 ; ASB3-004; intron 1

  OTTHUMT00000326159 ; ASB3-010; intron 1

  OTTHUMT00000324161 ; ASB3-005; intron 1

  OTTHUMT00000324080 ; ASB3-004; intron 1

  OTTHUMT00000326159 ; ASB3-010; intron 1

  OTTHUMT00000324161 ; ASB3-005; intron 1

  OTTHUMT00000324080 ; ASB3-004; intron 1

  OTTHUMT00000326159 ; ASB3-010; intron 1

  OTTHUMT00000324161 ; ASB3-005; intron 1

  ENST00000406625 ; ASB3-004; intron 1

  ENST00000498475 ; ASB3-010; intron 1

  ENST00000459916 ; ASB3-005; intron 1

  ENST00000352846 ; ASB3-201; intron 1

  ENST00000406625 ; ASB3-004; intron 1

  ENST00000498475 ; ASB3-010; intron 1

  ENST00000459916 ; ASB3-005; intron 1

  ENST00000352846 ; ASB3-201; intron 1

  ENST00000406625 ; ASB3-004; intron 1

  ENST00000498475 ; ASB3-010; intron 1

  ENST00000459916 ; ASB3-005; intron 1

  ENST00000352846 ; ASB3-201; intron 1

Database links

• ENTREZGENE: 100500850;MIR3682

Mature sequence hsa-miR-3682-5p

• Accession: MIMAT0019222
• Sequence: 15 - cuacuucuaccuguguuaucau - 36
• Evidence: experimental; Solexa [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3682-5p
  • MIRDB:hsa-miR-3682-5p
  • TARGETMINER:hsa-miR-3682-5p

Mature sequence hsa-miR-3682-3p

• Accession: MIMAT0018110
• Previous IDs: hsa-miR-3682
• Sequence: 50 - ugaugauacagguggagguag - 70
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3682-3p
  • MIRDB:hsa-miR-3682-3p
  • RNA22-HSA:hsa-miR-3682-3p
  • TARGETMINER:hsa-miR-3682-3p

References

1. PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).