Stem-loop sequence hsa-mir-3679

Accession

MI0016080

Description

Homo sapiens miR-3679 stem-loop

Stem-loop

            --a   ca          guuu 
cguggugaggau   ugg  gggaagggga    c
||||||||||||   |||  ||||||||||    c
guacuacuucua   acc  cccuucccuu    c
            aug   -c          aucu 

Deep sequencing

7 reads, 6 experiments

Genome context

• Coordinates (GRCh37.p5): chr2: 134884696-134884763 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000332272 ; MGAT5-003; intron 1

  OTTHUMT00000332273 ; MGAT5-004; intron 1

  OTTHUMT00000254584 ; MGAT5-001; intron 1

  OTTHUMT00000332272 ; MGAT5-003; intron 1

  OTTHUMT00000332273 ; MGAT5-004; intron 1

  OTTHUMT00000254584 ; MGAT5-001; intron 1

  OTTHUMT00000332272 ; MGAT5-003; intron 1

  OTTHUMT00000332273 ; MGAT5-004; intron 1

  OTTHUMT00000254584 ; MGAT5-001; intron 1

  ENST00000481801 ; MGAT5-003; intron 1

  ENST00000468758 ; MGAT5-004; intron 1

  ENST00000409645 ; MGAT5-001; intron 1

  ENST00000481801 ; MGAT5-003; intron 1

  ENST00000468758 ; MGAT5-004; intron 1

  ENST00000409645 ; MGAT5-001; intron 1

  ENST00000481801 ; MGAT5-003; intron 1

  ENST00000468758 ; MGAT5-004; intron 1

  ENST00000409645 ; MGAT5-001; intron 1

Database links

• ENTREZGENE: 100500878;MIR3679

Mature sequence hsa-miR-3679-5p

• Accession: MIMAT0018104
• Sequence: 6 - ugaggauauggcagggaagggga - 28
• Deep sequencing: 6 reads, 5 experiments
• Evidence: experimental; Solexa [1-3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3679-5p
  • MIRDB:hsa-miR-3679-5p
  • RNA22-HSA:hsa-miR-3679-5p
  • TARGETMINER:hsa-miR-3679-5p

Mature sequence hsa-miR-3679-3p

• Accession: MIMAT0018105
• Sequence: 44 - cuuccccccaguaaucuucauc - 65
• Evidence: experimental; Solexa [1,3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3679-3p
  • MIRDB:hsa-miR-3679-3p
  • RNA22-HSA:hsa-miR-3679-3p
  • TARGETMINER:hsa-miR-3679-3p

References

1. PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).